logo BDSP

Base documentaire


Votre avis nous intéresse

Le réseau BDSP met en oeuvre un projet d'innovation et d'amélioration de ses services, dans le souci constant de proposer des contenus de qualité adaptés aux besoins des utilisateurs.

Identifier de nouvelles sources de financements est la condition nécessaire pour assurer la poursuite et la pérennité de cet outil unique qu'est la BDSP, tout en le faisant évoluer.

Pour définir un nouveau modèle économique, nous avons besoin de votre avis : merci de répondre à notre enquête (temps estimé : 5 minutes).

Participer maintenant
Participer plus tard J'ai déjà participé

  1. Frequency of the cystic fibrosis deltaF 508 mutation in a population from Sao Paulo State, Brazil.

    Article - En anglais

    Cystic fibrosis (CF) nonrelated patients (N=24) from Sao Paulo State, Brazil, were screened for the presence of the deltaF 508 mutation by PCR amplification of the deletion region with the primers C16B(5'GTTTTCCTGGATTATGCCTGGGCAC3') and C16D(5'GTTGGCATGCTTTGAZTGACGCTTC3'), and by acrylamide gel electrophoresis.

    The allelic frequency of the deltaF 508 mutation was 33% (15/48 chromosomes).

    The genotype distribution among the patients showed 12.5% (N=3) of deltaF 508 homozygotes, 37.5% (N=9) of deltaF heterozygotes and 50% (N=12) ofnon-carriers of the mutation.

    Mots-clés Pascal : Mucoviscidose, Fréquence, Mutation, Gène, Génétique, Epidémiologie moléculaire, Brésil, Amérique du Sud, Amérique, Homme, Appareil respiratoire pathologie, Appareil digestif pathologie, Pancréas pathologie, Maladie héréditaire, Mutation deltaF 508

    Mots-clés Pascal anglais : Mucoviscidosis, Frequency, Mutation, Gene, Genetics, Molecular epidemiology, Brazil, South America, America, Human, Respiratory disease, Digestive diseases, Pancreatic disease, Genetic disease

    Logo du centre Notice produite par :
    Inist-CNRS - Institut de l'Information Scientifique et Technique

    Cote : 94-0089804

    Code Inist : 002B13C03. Création : 199406.